A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 17-May-2017 number of released structures: 8874
Search for released structures

NDB ID: 5J6U    PDB ID: 5J6U 



Molecular Description:

DNA (25-MER)

Nucleic Acid Sequence:

Click to show/hide 1 nucleic acid sequences

Protein Sequence:

No Protein Sequence Found

Primary Citation:

Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium 
To Be Published, , pp. - , 0.

Experimental Information:


Cell Constants:

a =   b =   c = (Ångstroms)

α =   β =   γ = (degrees)


The structure was refined using the program. The R value is for reflections in the resolution range to Ångstroms

Number of Models:

Number of Models: 11 Structures

Sample Details:

2 mM DNA (25-MER), 90% H2O/10% D2O 90% H2O/10% D2O